A ORIGEM DOS TELÔMEROS E CROMOSSOMOS LINEARES DOS EUCARIOTOS

Cromossomo é uma molécula de DNA condensada que contém vários genes. Em eucariotos, o DNA encontra-se disposto de forma semi-ordenada dentro do núcleo celular, agregado a proteínas estruturais, as histonas, que são como carretéis moleculares onde a molécula de DNA fica enrolada. Procariotos não possuem histonas, nem núcleo, e em sua forma não-condensada o DNA pode sofrer transcrição, regulação e replicação.

Os eucariontes possuem múltiplos cromossomos lineares dentro do núcleo celular. Cada cromossomo tem um centrômero, região mais condensada, normalmente no meio deste, onde as cromátides-irmãs entram em contato. As extremidades dos cromossomos possuem estruturas especiais chamadas telômeros. Desta conformação linear com extremidades teloméricas ocorre a eucariogênese, e aqui vamos tratar dos processos evolutivos que deram origem a eles.

Anatomia do cromossomo

Anatomia do cromossomo

A transição de um genoma ancestral circular para vários cromossomos lineares foi crucial para eucariogênese, pois permitiu uma rápida evolução adaptativa por meio de aneuploidia (alteração genética que leva ao número anormal de cromossomos). Cromossomos lineares tiveram uma dupla função biológica; a proteção e a segregação cromossômica que deu origem aos “proto-telômeros”.

A partir dos centrômeros surgiram regiões sub-teloméricas, geralmente formadas por interações de guanina-guanina e proteínas responsáveis pela proteção da heterocromatina telomérica, fundamentais para a manutenção ao longo da evolução. Em Drosophilas, regiões teloméricas podem conter remanescentes de como os primeiros proto-telômeros se originaram.

Os telômeros são formados por sequências repetitivas de DNA encontradas nas extremidades dos cromossomos lineares, desempenham um papel importante na regulação da proliferação celular. Tal região diminui com o passar da idade e afeta a proliferação de células em tecidos humanos, isto acarreta aumento mortalidade. Embora a seleção natural esteja amplamente associada á operação contra telômeros longos, eles implicam em maior risco de câncer. Acredita-se que o comprimento dos telômeros é limitado principalmente por restrições energéticas. A proliferação celular é energeticamente cara, e por isso telômeros mais curtos devem conduzir a um fenótipo econômico. Telômeros mais curtos restringem a imunidade adaptativa como um mecanismo de poupança de energia. Tal sistema imune também pode resultar em infecções crônicas, stress inflamatório, envelhecimento prematuro e morte. Com um tempo de vida reprodutiva aumentado, os custos do fitness do envelhecimento prematuro são mais elevados e os telômeros mais longos serão favorecidos pela seleção. Os telômeros também exibem um efeito paternal em que a descendência de pais mais velhos têm telômeros maiores devido aos comprimentos dos telômeros aumentados em espermatozóides resultado da idade. Este efeito paternal é um sinal de adaptação da idade esperada da reprodução masculina na prole. A descendência de linhagens de pais mais velhos tende á ter mais tempo, e assim, telômeros melhores preparados para um ambiente com idades mais elevadas esperadas na reprodução (Eisenberg, 2011).

A origem dos cromossomos lineares, telômeros e centrômeros – Proteção e segregação

Cromossomos lineares são encontrados em todos eu eucariotos, mas curiosamente estão presentes em outras linhagens celulares; em bactérias, incluindo as espiroquetas patogênicas (que causam a doença de Lyme) Borrelia afzelii, Borrelia burgdorferi e Borrelia garinii e o α-Proteobacteria Agrobacterium tumefaciens (Hinnebusch e Tilly, 1993; Volff e Altenbuchner, 2000; Bao e Cohen, 2003). Uma visão interessante sobre as propriedades dos cromossomos lineares veio do recente trabalho de cientistas japoneses, que deliberadamente linearizaram o cromossomo de E. coli, enzimas telomerase (TE1N) do fago lambdoid N15 (Cui et al, 2007). Surpreendentemente, as células com cromossomos linearizados foram totalmente viáveis e não diferiram a do tipo selvagem em relação à taxa de crescimento, morfologia das células ou níveis de expressão do gene. Os genes que codificam DNA girase (gyrB) e topoisomerase IV (parCparE) foram essenciais tanto para o tipo selvagem e para as cepas com cromossomos linearizado. De fato, cromossomos lineares ofereceram certas vantagens as estirpes de E. coli em relação a cromossomos circulares cuja recombinação cromossomal foi afetada por uma mutação em uma enzima, a recombinase XerCD (ou por uma deleção do sítio DIF), e exibiu um crescimento muito mais lento do que os mesmos mutantes que transportam os cromossomos linearizado (Cui et al, 2007). Parece razoável concluir que um genoma linear pode ter algumas vantagens quando se trata de resolução de dímeros cromossômicos (Galperin, 2007).

Notamos então que a linearidade dos cromossomos não é algo exclusivo de eucariotos, embora neles, a regra seja a linearidade e não a disposição circular que encontramos em procariotos. Na eucariogênese, existem algumas evidências fortes que explicam a origem de tais cromossomos, especialmente do ponto de vista molecular.

Após a endossimbiose de uma α-proteobactéria em um hospedeiro archaebacterial, houve uma intensa invasão de “íntrons móveis do grupo II (um grupo de ribozimas auto-catalíticas e elementos genéticos móveis encontrados dentro dos genes de todos os três domínios de vida) do simbionte no genoma circular do hospedeiro. Isto deu origem aos íntrons spliceossomais (sequências de íntrons específicos localizadas nas fronteiras entre éxons e íntros) (Koonin, 2006) que foram á força motriz para a origem da membrana nuclear, necessária para separar fisicamente o splicing lento de tradução rápida (Martin e Koonin 2006). Essa invasão levou à origem dos cromossomos eucariontes lineares (Villasante, Abad et al, 2007).

A tolerância do hospedeiro à invasão de elementos móveis e outras inovações eucarióticas poderiam ser facilitadas pelo tamanho efetivamente baixo da população e uma consequente seleção purificadora fraca (Lynch e Conery 2003); um tipo de seleção onde ocorre a remoção seletiva de alelos que são prejudiciais, podendo resultar na estabilização da seleção através da purificação de variações prejudiciais que surgem.

Íntrons móveis do grupo II são retroelementos de origem eubacteriana que contêm um RNA catalítico e uma proteína/enzima multifuncional, a enzima transcriptase reversa (TR) (Lambowitz e Zimmerly 2004). Estes retroelementos são ancestrais de ambos; os íntrons spliceossomais e o retrotransposon non-LTR (conhecido como non-LTR retrotransposons, cuja sigla é non-LTR e significa non-long terminal repeat) (Sharp, 1985).

Essa relação evolucionária entre ambos baseia-se na semelhança das suas sequências da enzima TR (Xiong e Eickbush 1990) e mecanismos de retrotransposição (Zimmerly et al, 1995).

Após a proliferação inicial de íntrons móveis do grupo II dentro do genoma nuclear proto-eucariótico, seus domínios de RNA degeneraram e deram origem a pequenas moléculas de RNA, chamadas de snRNAs spliceossomais que funcionavam de modo trans em um maquinário splicing comum (Sharp 1991 & Mohr et al, 2010).

Embora a maioria dos íntrons do grupo II evoluiu como íntrons eucarióticos, alguns perderam sua capacidade de splicing e derem origem a esses non-LTR. Essa ruptura contínua do cromossomo circular parece ter desencadeado diversos, talvez todos os mecanismos de reparação do DNA, incluindo o non-LTR.

Neste cenário evolutivo, é possível que a captura repetitiva de retrotransposons não-LTR, com uma cadeia enviesada G/C, nas extremidades do DNA de cadeia dupla poderia eventualmente resultar na proteção final, em vez de reparação, dando origem aos “proto-telômeros” dos primeiros cromossomos lineares. A distribuição de guanina e citosina entre as duas cadeias poderia ter sido selecionado porque sequências ricas em G têm a capacidade intrínseca de dobrar-se em estruturas secundárias chamadas de não-canônicas (que refletem a escolha incomum de base nitrogenada esperada). Elas foram utilizadas para o nivelamento ou sequestrar extremidades do cromossomo (Villasante, Abad et al, 2007).

Representação esquemática do possível cenário evolutivo para a origem dos cromossomos eucariontes. O esquema mostra a origem dos íntrons spliceossomais, a origem do núcleo (Koonin 2006; Martin e Koonin 2006) e também a origem proposta do "proto-telômero" ancestral com nivelamento e segregação de propriedades. O genoma eubacterial aparece em azul e o genoma archaebacterial em laranja.

Representação esquemática do possível cenário evolutivo para a origem dos cromossomos eucariontes. O esquema mostra a origem dos íntrons spliceossomais, a origem do núcleo (Koonin 2006; Martin e Koonin 2006) e também a origem proposta do “proto-telômero” ancestral com nivelamento e segregação de propriedades. O genoma eubacterial aparece em azul e o genoma archaebacterial em laranja. Clique para ampliar

A transposição gerou as primeiras repetições terminais que também permitiram o alongamento da porção terminal do cromossomo por mecanismos existentes de recombinação homóloga (Lange, 2004). Algo similar ocorreu em Drosophila, onde os telômeros são mantidos por retrotransposição de G/C e elementos não-LTR por recombinação terminal (Mason et al, 2008).

A enzima denominada nuclease universal de 5′—3′ é responsável pela clivagem (corte ou divisão) de extremidades de DNA criando saliências 3′ de cadeia simples (sigla ssDNA, de DNA single-strand) geralmente associadas a proteínas (do tipo A ou RPA). Esta proteína de ligação específica realiza vários processos de replicação do material genético, reparação e sinalização de danos o DNA. Ela também é um interruptor que regula o ciclo celular e o re-estabelecimento telomérico agindo como reparadoras do DNA após a replicação. Sabe-se que repetições teloméricas contendo RNA (cuja sigla em inglês é TERRA) contribui com o interruptor genético (Flynn et al, 2011) na organização estruturas da cromatina: em especial, na heterocromatina telomerica (Azzalin et al, 2007).

Assim, “proto-telômeros” com dupla função no nivelamento e segregação foram necessários para garantir herança precisas dos primeiros cromossomos eucarióticos lineares e a formação da primeira heterocromatina nas extremidades dos cromossomos recém-nascidos facilitou tanto o recrutamento de proteínas de proteção quanto a ligação de microtúbulos do fuso por meio de complexos de ribonucleoproteícos (Villasante, Abad et al, 2007). Posteriormente, com a eucariogênese ocorrendo, uma função de segregação evoluiu em regiões sub-teloméricas. Um mecanismo de troca desigual e conversão do gene levou inevitavelmente à divergência das repetições sub-teloméricas internas, e a assimetria das repetições formando estruturas secundárias independentes da seqüência que deram origem aos centrômeros (Villasante, Abad et al, 2007). Neste cenário, o aparecimento recorrente de cromossomos dicêntricos instáveis, através da formação de novos centrômeros de telômeros ocorreu e proporcionou um mecanismo adicional de fragmentação do genoma. O nascimento de vários cromossomos eucarióticos lineares foi a principal inovação que permitiu a evolução adaptativa por meio de aneuploidia transiente (duplicações cromossômica) (Chen et al, 2012;. Yona et ai, 2012).

Se centrômeros primitivos evoluíram a partir de “proto-telômeros,” seria razoável esperar que as regiões teloméricas também tenham algumas propriedades semelhantes ás centroméricas. Estudos revelam que isto de fato ocorre, em especial sob duas ocasiões: 1) em Schizosaccharomyces pombe (fungo Ascomycota), a eliminação de um centrômero endógeno leva à formação de um neo-centrômero em regiões sub-teloméricas (Ishii et al, 2008). Notou-se também que a sequência de DNA centromérica e sub-teloméricas possuíam características particulares que promoviam a incorporação da histona 3, específica de centrômeros (CENP-A) (Choi et al, 2012); 2) em Drosophila melanogaster, o centrómero do cromossomo Y contém uma grande variedade de elementos retrotransposos Het-A– e TART teloméricos (Agudo et al, 1999), além de sequência de DNA satélite que revelaram que as região centroméricas evoluíram a partir de um dos telômeros (Méndez-Lago et al, 2009).

As CENP-A de Drosophila induzem a formação preferencial de neo-centrômeros próximo aos telômeros (Heun et al, 2006 & Olszak et al, 2011); 3) em algumas plantas e animais, a atividade neo-centrômerica aparece na heterocromatina sub-telomérica durante a meiose (Puertas & Villasante 2013); e 4) a história evolutiva do cromossomo 3 em primatas mostra pelo menos três exemplos de intercâmbio funcional entre telômeros e centrômeros (Ventura et al, 2004).

Da mesma forma, outras conversões telômero-centrômero têm sido descritas após a análise comparativa de genomas de mamíferos (Murphy et al, 2005). Porque as repetições sub teloméricas poderiam ter um papel nestas conversões, este comportamento cromossômico pode ser devido à competência centromérica ancestral de uma região telomérica.

Se centrômeros primitivos começaram com uma cadeia enviesada G/C, nas extremidades do DNA de cadeia dupla, seria necessário entender a dinâmica da cromatina e como ela é formada em torno dos locais de ruptura e quais recursos semelhantes aos centrômeros estavam ali envolvidos. Aqui, também há evidências em favor da evolução.

Tem sido demonstrado que as proteínas centroméricas CENP-A, CENP-N, CENP-T, e CENP-L são rapidamente recrutadas para as extremidades do DNA de cadeia dupla ricas em C/G (Zeitlin et al, 2009) e claro, surpreendentemente, vários neo-centrômeros humanos foram localizados perto de rupturas (Ventura et al, 2003).

A proposta então é que a gênese do cromossomo eucariota esta ligada a origem de centrômeros que surgiram primeiramente e posteriormente deram origem aos telômeros, que provavelmente evoluíram a partir da replicação do cromossomo bacteriano (Cavalier-Smith, 1981). Recentemente, Cavalier-Smith (2010) sugeriu que ainda centrômeros surgiram primeiro e propôs que se originou a partir do locus de particionamento, uma região proximal da origem de replicação no cromossomo bacteriano. Mas Cavalier-Smith não explica como o genoma fragmentado de procariotas poderia dar origem ao centrômero de cada cromossomo linear recém-formado ou como foi o processo hipotético que levou à formação de centrômeros regionais contendo DNA repetitivos. Em apoio a um centrômero regional ancestral, um estudo recente feito com Saccharomyces cerevisiae encontrou regiões semelhantes a centrômero (sem uma seqüência específica de DNA) com estreita proximidade ao ponto nativo do centrômero. Estas pequenas regiões promovem a segregação adequada através de estruturas centroméricas independente da seqüência, e parecem ser os resquícios evolucionários derivados de um centrômero regional e não a partir de um centrômero pontual (Lefrançois et al 2013).

Na maioria dos cromossomos eucariontes, as sequências de DNA dos telômeros são seqüências curtas ricas em guaninas repetitivas que terminam em um 3′ (de 150 a 200 nucleotídeos). Uma fita rica em guanina é sintetizada por uma transcriptase reversa específica para telômeros, chamada de telomerase, que usa uma pequena região de sua subunidade de RNA como molde e o 3′-OH na extremidade do cromossomo como um iniciador (Blackburn, 1992). A árvore filogenética mostra que a telomerase parece ter evoluído a partir da transcriptase reversa, um ancestral retrotransposon non-LTR (Eickbush, 1997).

Encontrada em animais, fungos e Amoebozoa, TTAGGG é uma sequência telomérica simples de repetição presente no clado unikonta ancestral. Além disso, sua ocorrência em algumas espécies dos supergrupos Plantae, Chromalveolata, excavata, e Rhizaria sugere que tal sequência poderia corresponder á repetição telomérica ancestral para todos eucariotas (Fulnecková et al, 2013).

Uma árvore filogenética de retroelementos. A árvore no painel da esquerda foi feita usando RNA diretamente de RNAs polimerases. A árvore no painel da direita tem a mesma topologia, mas as sequências de RNA diretamente de RNAs polimerases são removidas e os retroelementos procariotos-mitocondriais formam a raiz de retroelementos eucarióticos. O comprimento de cada caixa corresponde à divergência dentro desse grupo. As sequências de aminoácidos dos sete domínios comuns a todas as transcriptases reversas foram usadas para gerar a árvore. Setas na parte inferior indicam as três origens independentes de vírus de retrotransposons (Eickbush, 1997).

Uma árvore filogenética de retroelementos. A árvore no painel da esquerda foi feita usando RNA diretamente de RNAs polimerases. A árvore no painel da direita tem a mesma topologia, mas as sequências de RNA diretamente de RNAs polimerases são removidas e os retroelementos procariotos-mitocondriais formam a raiz de retroelementos eucarióticos. O comprimento de cada caixa corresponde à divergência dentro desse grupo. As sequências de aminoácidos dos sete domínios comuns a todas as transcriptases reversas foram usadas para gerar a árvore. Setas na parte inferior indicam as três origens independentes de vírus de retrotransposons (Eickbush, 1997).

Telômeros à base de telomerase apresentam duas vantagens principais: a homeostasia de telômeros facilitada e uma maior proteção estrutural pela incorporação de repetições simples ricas em G com a capacidade inerente para formar estruturas G-quadruplex (Henderson et al, 1987).

Estruturas G-quadruplex consistem em quartetos empilhados, planos de quatro guaninas ligadas por pontes de hidrogênio de Hoogsteen (Neidle, 2009). A estrutura G-quadruplex pode ocorrer dentro do terminal rico em G formando uma saliência em 3´ ou quando a saliência invade a região de cadeia dupla adjacente do telômero para formar estruturas T-loop. (Maizels, 2006; Bochman et al, 2012).

É possível que antes da origem da telomerase, a manutenção dos telômeros era feita por mecanismos T-loop-de-replicação primitiva que torno-se menos relevante (Lange, 2004). A primeira visualização de formação telomérica G-quadruplex in vivo foi realizada em ciliados Stylonychia (Paeschke et al, 2005) e mais recentemente tem-se utilizado anticorpo específico para DNA G-quadruplex para visualizar as estruturas G-quadruplex em telômeros humanos (Biffi et al, 2013).

A sequência da telomerase ancestral (TTAGGG) não só é capaz de dobrar-se em uma estrutura G-quadruplex, mas é o melhor em fazê-lo in vitro (Tran et al, 2011).

Recentes estudo em biofísica utilizando G-quadruplexes teloméricas demonstraram que a formação da estrutura ocorre em milissegundos. Estas cinéticas dobráveis são biologicamente relevantes porque eles são comparáveis aos da transcrição e replicação do DNA (Zhang & Balasubramanian, 2012).

Durante a evolução, mutações no molde de RNA da enzima telomerase deram origem a variantes repetidas com diferentes comprimentos e modificações de guanina (G2, G4, e tantas outras). Experiências recentes descobriram que o G-quadruplexes formados por repetições teloméricas com apenas duas guaninas consecutivas (TTAGG de artrópodes e TTAGGC de vermes nemátodeos) estão em equilíbrio com outras estruturas não-canônicas (Tran et al, 2011).

Diagramas esquemáticos de um G-quarteto e dois G-quadruplexos teloméricos. A) Quatro guaninas montam uma disposição plana para formar um G-quarteto. As ligações de hidrogênio estão em linhas tracejadas. B) Diagrama de um G-quadruplexo intramolecular em uma extremidade dos telômeros. C) Diagrama de um G-quadruplexo em um T-loop. Os G-quadruplexos na figura são compostos por três G-quartetos empilhados (quadrados sombreados).

Diagramas esquemáticos de um G-quarteto e dois G-quadruplexos teloméricos. A) Quatro guaninas montam uma disposição plana para formar um G-quarteto. As ligações de hidrogênio estão em linhas tracejadas. B) Diagrama de um G-quadruplexo intramolecular em uma extremidade dos telômeros. C) Diagrama de um G-quadruplexo em um T-loop. Os G-quadruplexos na figura são compostos por três G-quartetos empilhados (quadrados sombreados).

Na mariposa da seda Bombyx mori (Lepidoptera – Satuniidae) e no besouro da farinha Tribolium castaneum (Coleoptera), a atividade da telomerase é fraca, e específicas de retroelementos telomeréricos sem LTR (elementos das famílias TRAS e SART em B. mori e SART em T. castaneum) são inseridos nas repetições teloméricas de uma forma específica (Fujiwara et al, 2005) que preserva a G/C.

A integração destes elementos nas regiões proximais das TTAGG repetidas de B. mori e as TCAGG de T. castaneum (uma variante alternativa dos telômeros em insetos) dá origem a enormes telômeros com tamanhos maiores do que 200 kb.

Os telômeros da abelha do mel Apis mellifera (Hymenoptera) são excepcionais entre os artrópodes, porque elas não têm elementos non-LTR inseridos em suas repetições teloméricas. Em vez disso, a sequência do telômero é composta repetições TTAGG (Robertson & Gordon 2006) intercaladas com TCAGGCTGGG, TCAGGCTGGGTTGGG, e TCAGGCTGGGTGAGGATGGG (Garavis et al, 2013). Essas repetições de ordem superior surgiram pela amplificação das repetições mutantes presentes em regiões teloméricas proximais e pelo padrão intercalado desenvolvido por mais amplificações das matrizes de repetição 5pb juntamente com maiores matrizes de repetição de pedidos.

Repetições TTAGG de Acyrthosiphon pisum (Hemiptera) e Pediculus humanus (Phthiraptera [piolho]) contêm inserções de retrotransposons non-LTR da família TRAS e SART (Garavis et al, 2013).

Como Hemiptera e Phthiraptera são basais para Hymenoptera, Coleoptera, Lepidoptera, Diptera e os telômeros de A. mellifera parecem representar um caso em que o TRAS e/ou retrotransposons de SART foram perdidos numa fase posterior na evolução.

Uma vez que os telômeros do ácaro Tetranychus urticae (a partir do ramo basal Chelicerata) são também um mosaico de repetições TTAGG curtas interrompidas por retrotransposons non-LTR estreitamente relacionados com TRAS (Grbić et al, 2011), então, os telômeros dos artrópodes parecem ser mantidos pela telomerase, por inserção de retrotransposons-LTR não específicas para as repetição TTAGG e por recombinação. O mesmo sistema de manutenção dos telômeros também foi encontrado em algumas espécies não artrópodes (Arkhipova e Morrison, 2001).

O aparecimento desse mecanismo aparentemente de manutenção dos telômeros estabeleceu certa instabilidade cromossômica, e parece ter coincidido com a grande radiação de artrópodes em Chelicerata e Mandibulata.

Por outro lado, certas leveduras do filo Ascomycota têm repetições teloméricas que são diferentes em termos da sua sequência, comprimento, e homogeneidade (McEachern e Blackburn, 1994). Nestas leveduras, as repetições degeneradas resultam do não processamento das telomerases (Prescott e Blackburn, 1997). Estas repetições, apesar da sua riqueza em T-G são menos propensas a dobrar em G-quadruplexos (Tran et al, 2011), e demonstrou-se que nestes organismos, as proteínas se ligam a telômeros evoluem rapidamente (Teixeira & Gilson 2005). Portanto, é possível que estas leveduras estejam utilizando um sistema de proteção ancestral do cromossomo onde as proteínas de ligação de ssDNA facilitando a dobragem das saliências 3′ em estruturas G-quadruplexas semelhantes.

Distribuição de sequências teloméricas dentro Bilateria. A maioria dos eucariontes tem sequencias repetidas ricas em guanina (G) sintetizado por telomerase complexos subteloméricos formado por sequências adjacentes que se repetem e são chamadas de TAS. Na maior parte dos artrópodes, retrotransposons específicos de telômeros são inseridos repetidamente e sintetizados por telomerase. Como pode ser visto no diagrama, elementos TRAS inserem em uma orientação inversa à dos elementos SART. Em um antepassado de diptera, o gene telomerase foi perdido (linha verde). Em Chironomus tentans (um Diptera inferior), as sequências teloméricas consistem em repetições em série mantidas por recombinação. No entanto, as espécies de Drosophila ter vários retrotransposons específicos de telômeros (autônomos e não-autônomos) que transpõem para extremidades cromossômicas. O evento de deleção no elemento TAHRE ancestral é mostrado com linhas tracejadas.

Distribuição de sequências teloméricas dentro Bilateria. A maioria dos eucariontes tem sequencias repetidas ricas em guanina (G) sintetizado por telomerase complexos subteloméricos formado por sequências adjacentes que se repetem e são chamadas de TAS. Na maior parte dos artrópodes, retrotransposons específicos de telômeros são inseridos repetidamente e sintetizados por telomerase. Como pode ser visto no diagrama, elementos TRAS inserem em uma orientação inversa à dos elementos SART. Em um antepassado de diptera, o gene telomerase foi perdido (linha verde). Em Chironomus tentans (um Diptera inferior), as sequências teloméricas consistem em repetições em série mantidas por recombinação. No entanto, as espécies de Drosophila ter vários retrotransposons específicos de telômeros (autônomos e não-autônomos) que transpõem para extremidades cromossômicas. O evento de deleção no elemento TAHRE ancestral é mostrado com linhas tracejadas.

Uma vez que a telomerase torna-se completamente disfuncional, a codificação do gene da telomerase pode ser perdida se os telômeros são mantidos pelo mecanismo ancestral alternativo de recombinação homóloga. Aparentemente, isto aconteceu no ancestral de Diptera a cerca de 260 milhões de anos (Wiegmann et al, 2011). Em dipteros inferiores como o Anopheles, Rhynchosciara e Chironomus repetições longas estão presentes em extremidades dos cromossomos, sugerindo que a manutenção dos telômeros ocorre por recombinação homóloga (Nielsen & Edstrom, 1993).

Em Drosophila, no entanto, a manutenção dos telômeros ocorre principalmente por transposição de retrotransposons específicos de telômeros que acabam recuando para as extremidades dos cromossomos. Telômeros de Drosophila também são mantidos, tal como em qualquer célula eucariótica, por recombinação/conversão de gene (Kahn et al, 2000).

Em D. melanogaster, três retrotransposons teloméricos TART, TAHRE, e Het-A transpõe ocasionalmente no final do cromossomo usando a extremidade livre 3′-OH no cromossomo para preparar a transcrição reversa (Biessmann et al, 1990). Neste mecanismo, elementos teloméricos aparecem misturados aleatoriamente em arranjos cabeça-com-cauda e variavelmente truncado na extremidade 5 ‘(Mason et al, 2008). Notou-se também que a deleção de uma região que codifica a transcriptase reversa dos elementos teloméricos recorrentemente ocorreu durante a evolução de Drosophila, e múltiplos elementos não-autônomos aparecem nos telômeros das espécies de Drosophila analisadas. Como um exemplo, até quatro elementos não-autônomos, juntamente com os seus correspondentes elementos autônomos têm sido encontrados em telômeros de D. mojavensis (Villasante et al, 2007). Curiosamente, em situações semelhantes ocorrem com o grupo II íntrons onde suas transcriptases reversas também atuam de modo trans para mobilizar vários íntrons excluídos (Mohr et al, 2010).

Isto ocorre porque os telômeros de Drosophila consistem em matrizes de retrotransposons em fluxo constante, não há uma sequência terminal específica, além do que, suas proteínas teloméricas evoluíram para ligar as extremidades do cromossomo independentemente da sequência de DNA primário (Raffa et al, 2009, 2010).

O complexo terminal é funcionalmente análogo ao complexo das proteínas teloméricas humanas embora seus componentes não sejam evolutivamente conservados (Palm & Lange 2008; Raffa 2009 et al, 2010). Assim, os telômeros de Drosophila foram forjados por uma rápida evolução de retrotransposons e proteínas teloméricas (Villasante et al, 2007).

Análises estruturais e filogenéticas de todos os retrotransposons específicos teloméricos de Drosophila mostram que eles tinham um ancestral comum e indicam que retrotransposons não-LTR não foram recrutados para executar a função de manutenção celular dos telômeros, de tal forma, que as evidências que o recrutamento de elementos teloméricos de Drosophila podem assemelhar-se ao mecanismo ancestral que levou à manutenção dos “proto-telômeros” dos primeiros cromossomos eucarióticos (Garavis et al, 2013).

Já as células de levedura em que falta a telomerase podem sobreviver á perda de sequência dos telômeros através da formação de blocos terminais de heterocromatina. Isso acontece, amplificando e reorganizando tanto sequências sub-teloméricas em S. cerevisiae e S. pombe ou a partir de sequências de DNA recombinante em S. pombe (Lundblad e Blackburn, 1993).

Em espécies que perderam telomerase, quer durante a evolução (especialmente a Ordem Diptera) ou através de manipulação experimental, os dados disponíveis sugerem que a função e as características do DNA estrutural na manutenção dos telômeros devem ter uma grande importância na heterocromatina telomérica (independentemente da sequência primária) no recrutamento de ligação proteicas nas porções terminais. Elas mostram como facilmente mecanismos de cópia de segurança podem ter sido usados para manter os telômeros durante a evolução (Garavis et al, 2013).

Assim, em conclusão, é notável que estruturas secundárias polimórficas com base em interações guanina-guanina evoluíram em conjunto com proteínas para permitir a origem e evolução dos telômeros. Além disso, existe grande suporte empírico para a hipótese de que os primeiros cromossomos eucarióticos lineares surgiram com o aparecimento de “proto-telômeros” na cadeia enviesada G/C e nas extremidades do DNA de cadeia dupla. Esta estrutura do terminal ancestral teve a dupla função; proteção e segregação. Além disso, a formação concomitante da heterocromatina “proto-telomérica” foi fundamental para esta inovação evolutiva-chave (Garavis et al, 2013).

Victor Rossetti

Palavras chave: NetNature, Rossetti, Cromossomos Lineares, Telômeros, Centrômeros, G-quadruplex, Guanina, Telomerase, DNA não-canônico, Transcriptase reversa, Eucariogênese.

 

Referências

Arkhipova IR, Morrison HG. Three retrotransposon families in the genome of Giardialamblia: two telomeric, one dead. Proc Natl Acad Sci U S A. 2001;98:14497-14502
Azzalin CM, Reichenbach P, Khoriauli L, Giulotto E, Lingner J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 2007;318:798-780
Bao K. Recruitment of terminal protein to the ends of Streptomyces linear plasmids and chromosomes by a novel telomere-binding protein essential for linear DNA replication. Genes Dev. 2003;17:774–785.
Biffi G, Tannahill D, McCafferty J, Balasubramanian S. Quantitative visualization of DNA G-quadruplex structures in human cells. Nat Chem. 2013;5:182-186.
Biessmann H, Kobeski F, Walter MF, Kasravi A, Roth CW. DNA organization and length polymorphism at the 2L telomeric region of Anopheles gambiae. Insect Mol Biol. 1998;7:83-93.
Blackburn EH. Telomerases. Annu Rev Biochem. 1992;61:113-129.
Bochman ML, Paeschke K, Zakian VA. DNA secondary structures: stability and function of G-quadruplex structures. Nat Rev Genet. 2012;13:770-780.
Cavalier-Smith T. The origin and early evolution of the eukaryotic cell. In: Carlile MJ, Collins JF, Moseley BEB, editors. Molecular and cellular aspects of microbial evolution. Cambridge: Cambridge University Press; 1981. p. 33-84.
Cavalier-Smith T. Origin of the cell nucleus, mitosis and sex: roles of intracellular coevolution. Biol Direct. 2010;5:7.
Chen G, Rubinstein B, Li R. Whole chromosome aneuploidy: big mutations drive adaptation by phenotypic leap. Bioessays 2012;34:893-900.
Choi ES, et al. Factors that promote H3 chromatin integrity during transcription prevent promiscuous deposition of CENP-A (Cnp1) in fission yeast. PLoS Genet. 2012;8(9):e1002985.
Cui T, et al. Escherichia coli with a linear genome. EMBO Rep. 2007;8:181–187.
Eickbush TH. Telomerase and retrotransposons: which came first? Science 1997;277:911-912.
Eisenberg, D. T. A.An evolutionary review of human telomere biology: The thrifty telomere hypothesis and notes on potential adaptive paternal effects. Volume 23, Issue 2, pages 149–167, March/April 2011
Flynn RL, et al. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. Nature 2011;471:532-536.
Fujiwara H, Osanai M, Matsumoto T, Kojima KK. Telomere specific non-LTR retrotransposons and telomere maintenance in the silkworm, Bombyx mori. Chromosome Res. 2005;13:455-467.
Fulnecková J, et al. A broad phylogenetic survey unveils the diversity and evolution of telomeres in eukaryotes. Genome Biol Evol. 2013;5:468-483.
Galperin, M. Y. Linear chromosomes in bacteria: no straight edge advantage? Environ Microbiol. 2007 May; 9(6): 1357–1362.
Garavís, M. González, C. Villasante, A. On the Origin of the Eukaryotic Chromosome: The Role of Noncanonical DNA Structures in Telomere Evolution. Genome Biol Evol (2013) 5 (6): 1142-1150.
Grbić M, et al. The genome of Tetranychus urticae reveals herbivorous pest adaptations. Nature 2011;479:487-492.
Henderson E, Hardin CC, Walk SK, Tinoco I Jr., Blackburn EH. Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine-guanine base pairs. Cell 1987;51:899-908.
Heun P, et al. Mislocalization of the Drosophila centromere-specific histone CID promotes formation of functional ectopic kinetochores. Dev Cell. 2006;10:303-315.
Hinnebusch J. Linear plasmids and chromosomes in bacteria. Mol Microbiol. 1993;10:917–922.
Ishii K, et al. Heterochromatin integrity affects chromosome reorganization after centromere dysfunction. Science 2008;321:1088-1091.
Kahn T, Savitsky M, Georgiev P. Attachment of HeT-A sequences to chromosomal termini in Drosophila melanogaster may occur by different mechanisms. Mol Cell Biol. 2000;20:7634-7642.
Koonin EV. The origin of introns and their role in eukaryogenesis: a compromise solution to the introns-early versus introns-late debate? Biol Direct. 2006;1:22.
Lambowitz AM, Zimmerly S. Mobile group II introns. Annu Rev Genet. 2004;38:1-35.
Lange T. T-loops and the origin of telomeres. Nat Rev Mol Cell Biol. 2004;5:323-329.
Lefrançois P, Auerbach RK, Yellman CM, Roeder GS, Snyder M. Centromere-like regions in the budding yeast genome. PLoS Genet. 2013;9:e1003209.
Lundblad V, Blackburn EH. An alternative pathway for yeast telomere maintenance rescues est1-senescence. Cell 1993;73:347-360
Lynch M, Conery JS. The origins of genome complexity. Science 2003;302:1401-1404.
Maizels N. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat Struct Mol Biol. 2006;13:1055-1059.
Martin W, Koonin EV. Introns and the origin of nucleus-cytosol compartmentalization. Nature 2006;440:41-45
Mason JM, Frydrychova RC, Biessmann H. Drosophila telomeres: an exception providing new insights. Bioessays 2008;30:25-37.
McEachern MJ, Blackburn EH. A conserved sequence motif within the exceptionally diverse telomeric sequences of budding yeasts. Proc Natl Acad Sci U S A. 1994;91:3453-3457
Méndez-Lago M, et al. Novel sequencing strategy for repetitive DNA in a Drosophila BAC clone reveals that the centromeric region of the Y chromosome evolved from a telomere. Nucleic Acids Res. 2009;37:2264-2273.
Mohr G, Ghanem E, Lambowitz AM. Mechanisms used for genomic proliferationby thermophilic group II introns. PLoS Biol. 2010;8(6):e1000391.
Murphy WJ, et al. Dynamics of mammalian chromosome evolution inferred from multispecies comparative maps. Science 2005;309:613-617.
Neidle S. The structures of quadruplex nucleic acids and their complexes. Curr Opin Struct Biol. 2009;9:239-250.
Nielsen L, Edstrom JE. Complex telomere-associated repeat units in members of the genus Chironomus evolve from sequences similar to simple telomeric repeats. Mol Cell Biol. 1993;13:1583-1589.
Olszak AM, et al. Heterochromatin boundaries are hotspots for de novo kinetochore formation. Nat Cell Biol. 2011;13:799-808.
Paeschke K, Simonsson T, Postberg J, Rhodes D, Lipps HJ. Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo. Nat Struct Mol Biol. 2005;12:847-854.
Palm W, de Lange T. How shelterin protects mammalian telomeres. Annu Rev Genet. 2008;42:301-334.
Prescott J, Blackburn EH. Telomerase RNA mutations in Saccharomyces cerevisiae alter telomerase action and reveal nonprocessivity in vivo and in vitro. Genes Dev. 1997;11:528-540.
Puertas MJ, Villasante A. Is the heterochromatin of meiotic neocentromeres a remnant of the early evolution of the primitive centromere? In: Jiang J, Birchler JA, editors. Plant centromere biology. Oxford (UK): Wiley-Blackwell; 2013. p. 95-109.
Raffa GD, et al. The Drosophila modigliani (moi) gene encodes a HOAP-interacting protein required for telomere protection. Proc Natl Acad Sci U S A. 2009;106:2271-2276.
Raffa GD, et al. Verrocchio, a Drosophila OB fold-containing protein, is a component of the terminin telomere-capping complex. Genes Dev. 2010;24:1596-1601.
Robertson HM, Gordon KH. Canonical TTAGG-repeat telomeres and telomerase in the honey bee, Apis mellifera. Genome Res. 2006;16:1345-1351.
Sharp PA. On the origin of RNA splicing and introns. Cell 1985;42:397-400.
Sharp PA. “Five easy pieces”. Science 1991;254:663.
Teixeira MT, Gilson E. Telomere maintenance, function and evolution: the yeast paradigm. Chromosome Res. 2005;13:535-548.
Tran PL, Mergny JL, Alberti P. Stability of telomeric G-quadruplexes. Nucleic Acids Res. 2011;39:3282-3294.
Ventura M, et al. Neocentromeres in 15q24–26 map to duplicons which flanked an ancestral centromere in 15q25. Genome Res. 2003;13:2059-2068.
Ventura M, et al. Recurrent sites for new centromere seeding. Genome Res. 2004;14:1696-1703.
Villasante A, Abad JP, Méndez-Lago M. Centromeres were derived from telomeres during the evolution of the eukaryotic chromosome. Proc Natl Acad Sci U S A. 2007;104:10542-10547.
Volff JN. A new beginning with new ends: linearisation of circular chromosomes during bacterial evolution. FEMS Microbiol Lett. 2000;186:143–150.
Wiegmann BM, et al. Episodic radiations in the fly tree of life. Proc Natl Acad Sci U S A. 2011;108:5690-5695
Xiong Y, Eickbush T. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 1990;9:3353-3362.
Yona AH, et al. Chromosomal duplication is a transient evolutionary solution to stress. Proc Natl Acad Sci U S A. 2012;109:21010-21015.
Zeitlin SG, et al. Double-strand DNA breaks recruit the centromeric histone CENP-A. Proc Natl Acad Sci U S A. 2009;106:15762-15767.
Zhang AY, Balasubramanian S. The kinetics and folding pathways of intramolecular g-quadruplex nucleic acids. J Am Chem Soc. 2012;134:19297-19308.

Zimmerly S, Guo H, Perlman PS, Lambowitz AM. Group II intron mobility occurs by target DNA-primed reverse transcription. Cell 1995;82:545-554.

Deixe uma resposta

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair / Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair / Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair / Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair / Alterar )

Conectando a %s